Jonas Brothers en Lima

jonasJonas Brothers, una de las más famosas bandas de pop de la actualidad, anunció que iniciará una serie de presentaciones por Latinoamérica y Estados Unidos, que incluye una fecha para nuestra capital, el próximo martes 19 de mayo.

Kevin, Joe y Nick informaron a todos sus fanáticos la lista oficial del tour a través de MySpace y la web oficial de los Jonas Brothers, aunque aún no se ha definido el lugar donde tocarán sus electricos temas como ‘Kids of the Future’.

Estos tres hermanos que la vienen rompiendo tras ganar gran popularidad en Disney Channel y la película ‘Camp Rock’, pisarán suelo peruano en su máximo apogeo, antes de viajar a Chile, Argentina y Brasil.

¿Quiénes son los Jonas Brothers?
Los Jonas Brothers son una banda pop originaria de Nueva Jersey, Estados Unidos, compuesta por tres hermanos: Kevin, Joe y Nick Jonas. Tiene gran acogida entre el público infantil y adolescente.
Han publicado tres álbumes de estudio ‘It’s About Time’ en 2006, ‘Jonas Brothers’ en 2007, y ‘A Little Bit Longer’ en 2008, además de estrenar este año el ‘Jonas Brothers: The 3D Concert Experience Sound Track’.
También han realizado películas como ‘Jonas Brothers: Living the Dream’, ‘J.O.N.A.S!’ y ‘Camp Rock 1 y 2’.
El 2008 ganaron el premio MTVLA a ‘Mejor artista pop internacional’ y ‘Mejor fashionista (Joe Jonas)’.
Fuente: Peru.com
Videos:
Jonas Brothers – Burnin Up
Jonas Brothers – Kids of the Future

Anuncios

81 comentarios (+¿añadir los tuyos?)

  1. sandy
    Mar 14, 2009 @ 17:48:42

    wuuuuu!!! los jonas brothers en lima siiiiii!!!
    ellos son la mejor banda de todo el mundooo!!

    Responder

  2. jessica
    Mar 17, 2009 @ 23:13:04

    waooooooooooooooo!!!! no lo puedo kreer!!!!!!
    ovbio k tngo k ir adelantito obvio

    Responder

  3. carla
    Mar 19, 2009 @ 02:39:45

    los amo …voy a hacer de todo por verlos ..los amo …joe (L)

    Responder

  4. mariana
    Mar 19, 2009 @ 11:50:20

    Ola! estoy re emocionada x favor si a lguien sabe cuanto estan las entradas para peru i donde las venden agregenme marianaaguirre1@hotmail.com

    Responder

  5. kimi
    Mar 20, 2009 @ 02:32:23

    wauuu esta es una emocion grandiosa,tanto que los esperabamos ya van a estar aqui el 19 de mayo que locura ovio que tengo que ir

    Responder

  6. JOEL
    Mar 20, 2009 @ 18:46:05

    DONDE Y CUANDO Y CUANTO ESTAN LAS ENTRDAS ?¿? ….

    Responder

  7. cathy y kenny escudero ramirez
    Mar 21, 2009 @ 15:06:33

    somos sus fans los amamos sus musica son de sentimiento y ademas son lindooooooooooos .
    nosotras queremos sus autografos no faltaremos al concierto en primera fila . los queremos JOE,NICK,KEVIN

    Responder

  8. crtius
    Mar 22, 2009 @ 00:56:45

    Hello!! Jonas usdtsss!! son de lo mejor aun que no los conosca del todo… bueno ahi los vere donde sea que esten … derre me hago pasar por una reportera =) …

    Responder

  9. maferrr.!
    Mar 22, 2009 @ 18:44:10

    waO..!
    obviiO q tengO q iR esta brabazO.. ! lOs jonas estan en sintonia..! bravazo cuanto estan las entradas???? manden si? I lOve jOe..!

    Responder

  10. valeria
    Mar 24, 2009 @ 20:47:39

    ahi quiero decirles que los amo mas a jouuuuuuuuuuuuuuu
    me encantan sus canciones soy su fan numero uno los amooooooooooooooooooooooooooooooooooooooooooooooooo y ovioooooooooooooooooo que voy asu concierto de este año osea año
    2009

    Responder

  11. valeria
    Mar 24, 2009 @ 20:47:44

    ahi quiero decirles que los amo mas a jouuuuuuuuuuuuuuu
    me encantan sus canciones soy su fan numero uno los amooooooooooooooooooooooooooooooooooooooooooooooooo y ovioooooooooooooooooo que voy asu concierto de este año osea año
    2009

    Responder

  12. valeria
    Mar 24, 2009 @ 20:50:10

    hay quiero decirles que los adoro ovio que mas a jou ahy te amo bueno a los tres y oviooooooooooo que voy a su concierto de este año osea año 2009

    besossssssssssssssssssss
    los adorooooooooooooooo

    Responder

  13. ENTRADAS GRATIS
    Mar 24, 2009 @ 23:04:12

    ENTRADAS GRATIS…solo para las chikas atrevidas que deseen unas entradas gratis, para el primer y quizas unico concierto de los Jonas brothers.. solo chikas dispuesta a todo.. por unas entradas para el unico concierto en lima … las chikas positivas y atrevidas escribirme a mi correo mi_angel730@hotmail.com
    solo chikas atrevidas nada mas..

    Responder

  14. ENTRADAS GRATIS
    Mar 24, 2009 @ 23:05:56

    las entradas estarn mino 120 soles la general y las mas caras zona vip 500 soles

    Responder

  15. Jack(y)
    Mar 27, 2009 @ 00:29:10

    deveras …eson son los precios??????????
    y donde va serr???

    Responder

  16. gustavo simon
    Mar 28, 2009 @ 14:40:10

    los jonas brothers son uno cobardes basuras de mierda , el concierto de kiss va a estar mas bravaso, viva queen, kiss y iron maiden

    Responder

  17. jimena
    Mar 28, 2009 @ 22:31:03

    los amo…… siempre quieze q vinieran ovio q voy a estsar a primera fila lo amo a joeeeeeeeeeeeeeeeeeeeeeeee
    mucoh
    estoy felis pero tengo q averiguar ojala q sea en el monumental para q valla tanta gente q se muere po ir

    Responder

  18. anonimo
    Mar 29, 2009 @ 01:28:32

    atrevanse a venir a lima cabrones de
    mierda yo los buscare y los matare
    me bañare en su sangre y a todos sus
    fanaticos y tambien a su productor y
    familia.

    Responder

  19. gustavo simon
    Mar 29, 2009 @ 12:35:04

    mueranse jonas brothers,ya se su secreto
    violaron a una anciana para el colmo desnudos
    ya los ampaye cabrones de mierda,tambien me entere q hablron mal de queen y de kiss
    ustedes los jonas brothers no valen nada
    mueranse malditos,los jonas brothers son unos
    estupidossssssssssssssssssss

    Responder

  20. yo soi :)
    Mar 30, 2009 @ 22:52:04

    PUTAAA WEON! SI NO TE GUSTA LOS JONAS TU ROCHE PUES!. PERO NO VENGAS A INSULTARLOS NI NADA QUEDAS MAL*

    JONASSSSSSS SON TODOO <3*

    Responder

  21. MAI
    Mar 30, 2009 @ 22:53:57

    COMETEELAA!!

    PARA EL WEOND E GUSTAVO! -.-

    Responder

  22. MAI
    Mar 30, 2009 @ 22:54:02

    COMETEELAA!!

    PARA EL WEON DE GUSTAVO! -.-

    Responder

  23. fiorellita
    Mar 31, 2009 @ 00:21:33

    super estare en primera fila
    no me la prdere.
    por naa delmundo aunq llueva
    I LOVE JOEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE

    Responder

  24. iO phee..^^!
    Mar 31, 2009 @ 21:46:14

    ENTRADAS GRATIS…solo para las chikas atrevidas que deseen unas entradas gratis, para el primer y quizas unico concierto de los Jonas brothers.. solo chikas dispuesta a todo.. por unas entradas para el unico concierto en lima … las chikas positivas y atrevidas escribirme a mi correo mi_angel730@hotmail.com
    solo chikas atrevidas nada mas..

    _____________

    ii ezteh??..
    qe creeh qe le vamoz..
    azer cazO..!
    taz weon..
    buzcateh en OtrO ladO..
    a xiqaz ardientez….
    estupidoh!
    daz pena..
    tan necezitadO eztaz??
    ajjj daz pena!

    Responder

  25. gustavo simon
    Abr 01, 2009 @ 19:00:56

    no me interesa sus comentarios,igual los mato
    custe lo que cueste,ya se cuando van a venir
    y en que estadio y a que hora,yo vendre armado
    y los 3 moriran 1×1,jonas brothers mueranse
    cabrones de mieda,ya estoy preparado
    viva kiss,queen y iron maiden

    Responder

  26. melany
    Abr 01, 2009 @ 19:58:39

    holas chicos estoy contenta que venga a peru
    soy una niña de nueve años
    y soy fan de ustedes

    Responder

  27. melany
    Abr 01, 2009 @ 20:03:07

    chicos quiero pedirles algo

    Responder

  28. melany
    Abr 01, 2009 @ 20:10:13

    una perganta demi lovato viene

    Responder

  29. io!!
    Abr 02, 2009 @ 05:06:30

    jou????
    ES JOE!

    mff!

    SII DEMI LOVATO ES TELONERA!!!
    PERO CUANTO ESTAN LAS ENTRADAS

    NO CREO KE SEAN CAPACES DE CREER LO D LAS ENTRADAS GRATIS NO=???

    DBE SER ALGUN ENFERMO NO AGAN CASO!

    LAS NTRADAS NI SIKIERA SE EMPIEZAN A VENDER

    XFAS EL PRECIO REAL!! DE LAS ENTRADAS NO VNGAN CON WEADAS XFAVOR

    Responder

  30. Carmen
    Abr 02, 2009 @ 18:02:20

    Chicas URGENTE
    Por favor no den sus correos personales a NADIE, no den sus datos, no se citen con nadie… y menos confien en que les regalaran entradas.
    Eso es MENTIRA, esa persona solo quiere abusar de ustedes, engañarlas, hacerles daño.
    Por favor CUIDENSE, valorense, no se arriesguen.

    Carment

    Responder

  31. laura
    Abr 02, 2009 @ 22:08:53

    QUE ESTUPIDO!!!, HAY ME ENCANTARIA QUE DE CASUALIDAD ALGUIEN DE SUS REPRESENTANTES LEA TU COMENTARIO HABER SI TE METEN A LA CARCEL, PORQUE ESO SE LLAMA AMENAZA!… Y SI NO TE GUSTAN ANDATE A LA MI**DA!… oie kiss no me gusta xk se pintan mas k e las mujeres que clase de grupo es ese…METALERO D MI-…

    Responder

  32. laura
    Abr 02, 2009 @ 22:09:47

    la mas cara esta 1306.7 soles

    Responder

  33. humberto
    Abr 02, 2009 @ 22:49:37

    quiero saber cuanto tan las entradas gracias

    Responder

  34. Ximena
    Abr 03, 2009 @ 02:30:24

    mas de 1000 soles la mas cara????? por dios!! es un escandalooo un escandalo totaaaaal!!!!!!!!!!!!!!!!!!!!!!! que pena que tan caras las entradas en verdad que sip…queria llevara mi hijita que ama a los jonas adelante pero taan carooo?? dios mio!!!! ni siquiera U2 cobraria asi!!!! ESCANDALOOO y LOs impuestos reducidos en donde estan en este caso????

    Responder

  35. ALIAS
    Abr 03, 2009 @ 04:17:35

    BUENO AMIGOS Y AMIGAS, RESPETO A TODA PERSONA QUE TENGA PREFERENCIAS POR UNO U OTRO GRUPO O SOLISTA, NO ME IMPORTA, YO SOY FANATICO DE IRON MAIDEN Y DE OTRAS BANDAS NO METAL, PERO EN ESTE CASO LES QUIERO DECIR QUE ESTE SEÑOR KOKI FERNANDEZ DE PEOPLE & MUSIC SE ESTA VOLVIENDO MUY AMBICIOSO, PORQUE NO ES MALO TENER AMBICIONES PERO SER AMBICIOSO DE TAL FORMA QUE PISOTEES A TU PROJIMO, ESO SI ES MALO, Y ES QUE ESTE SEÑOR DE P&MUSIC, NOS HA ESTAFADO A LOS QUE HEMOS IDO A VER A MAIDEN, PORQUE POR AHORRARSE UNOS BILLETES NO QUISO PAGAR O NO SE ESFORZO EN PAGAR A TIEMPO LA PIROTECNIA PARA QUE PASE LA ADUANA, PORQUE ERA PARTE DEL ESPECTACULO, EN FIN YO LO DISFRUTE AL MAXIMO PORQUE LA BANDA LO DIO TODO, PERO ESTE SEÑOR SE ESTA CONVIRTIENDO EN UN CODICIOSO Y YA LO ESTOY VIENDO CON LOS PRECIOS DE LAS ENTRADAS AL CONCIERTO DE LOS JONAS BROTHERS, TIENEN QUE DARSE CUENTA QUE ESTE SEÑOR Y SU EMPRESA SE HAN VUELTO AMBICIOSOS Y NO LE IMPORTA EL RESTO, BUENO SOLO LES DIGO MI OPINIÓN, POR LO PRONTO MUCHAS GENTE QUE FUE AL CONCIERTO DE MAIDEN LO ESTAN DENUNCIANDO ANTE INDECOPI Y ASPEC A ESTE SEÑOR Y A SU EMPRESA POR ESTAFA Y PUBLICIDAD ENGAÑOSA……….DEPENDE DE USTEDES DE APOYAR A ESTE SEÑOR, QUE PENA POR USTEDES PORQUE SE LO QUE SE SIENTE SER FANATICO, PERO ES LA REALIDAD, ESPERO TOMEN LA MEJOR DECISIÓN, PERO NO SE OLVIDEN LOS IMPUESTOS BAJARON CONSIDERABLEMENTE, ENTONCES PORQUE TAN CARO LOS PRECIOS……..JUZGEN USTEDES MISMOS.

    Responder

  36. lidia
    Abr 03, 2009 @ 14:40:06

    siiiiiiiiiiiiiiiiiiiiiiiiiiiiiii los amoooooooooooooooooooo
    pense k nunka vendriaaaaannnnnnnn!!!!!! no l puedo creer!!!!!
    alguien ya kompro su entrada ????
    kuanto estann???????
    RESPONDAN XFAAAAAA

    Responder

  37. Renato
    Abr 03, 2009 @ 22:00:05

    Hola!!!
    Nadie a comprado entradas porque ni comerciales y a mi tambien me gusta.

    Responder

  38. belu
    Abr 03, 2009 @ 23:23:43

    los amo especial mente a nick es un bombom tengo todas sus fotos bengan a salta capital argentina loooooooooooooooooooooooooooooosssssssssssssssssssssssssssssssssssssssssssss aaaaaaaaaaaaaaaaammmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmoooooooooooooooooooooooooooooooooooooooooo

    Responder

  39. angela
    Abr 04, 2009 @ 04:16:08

    oye no lo puedo creer yo me apunto y me subo hayyyyyyyyyyyyyyyyyyyyy los amos jonas brothers soy su fans numero 1 de peru

    Responder

  40. andreiitap
    Abr 04, 2009 @ 18:05:29

    oLz aKii lz djo l PrEZiio dE laz nTrAdAz

    GOLDEN CIRCLE – NORMAL – S/. 1306.7
    BURNIN UP – NORMAL – S/. 1120
    LOVEBUG – A – NORMAL – S/. 840
    WE ROCK PALCO – NORMAL – S/. 786.7
    WE ROCK VIP – NORMAL – S/. 720
    LOVEBUG – B -NORMAL – S/. 693.3
    MANDY – NORMAL – S/. 586.7
    LOVEBUG – C – NORMAL – S/. 560
    A LITTLE BIT LONGER – NORMAL – S/. 520
    KIDS OF THE FUTURE – NORMAL – S/. 426.7
    KIDS OF THE FUTURE – PULLMAN – NORMAL – S/. 426.7
    YEAR 3000 – NORMAL – S/. 293.3
    S.O.S. – A – NORMAL – S/. 253.3
    S.O.S. – B – NORMAL – S/. 160
    S.O.S. – C – NORMAL – S/. 106.7
    TRIBUNA – NORMAL – S/. 53.3

    Responder

  41. july
    Abr 04, 2009 @ 19:51:09

    les queria preguntar si saven cuando yegan los jonas a argentina y donde aterrisan.gracias july .
    i love jonas brathers
    i love joe jonas¡¡¡¡¡¡¡te amooooo¡¡

    Responder

  42. july
    Abr 04, 2009 @ 19:54:14

    les queria preguntar si saven cuando yegan los jonas a argentina y donde aterrisan.gracias july .
    i love jonas brathers
    i love joe jonas¡¡¡¡¡¡¡te amooooo¡¡

    Responder

  43. karina
    Abr 05, 2009 @ 21:05:15

    luego de leer algunos de lso comentarios quisiera expresar mi preocupacion por el precio de las entradas, estan incentivando con esto el emcaprichamiento de las ninias que no entienden el valor del dinero y que exigen quiza no verbal pero si psicologicamente a sus padres a comprarles estas entradas que estan terriblemente caras. Creo que deben tomar con cuidado temas como el fanatismo. Pueden amar a los JB pero deben entender que hay cosas que se pueden cumplir y otras que no.

    Responder

  44. angie
    Abr 06, 2009 @ 01:36:05

    JONAS BROTHERS LOS AMOOOOOOOOOOO…..
    Y AHORA K VIENEN NO VOY HA PODER VERLOS PERO ME GUSTARIA K VENGAN HA ESTE SITIO PERU-LIMA-SAN JUAN DE LURIGANCHO . VAN AL COLEGIO DEL SANTO DOMINGO DE GUZMAN DE LAS FLORES PORFIS NO SABEN LO MAL K ME SIENTO NO PODER IR A VERLOS LOS AMOOOOOOOOOOOOOOOOOOOOOOOOO……………………….. HA LOS TRES.
    MI PRIMA TAMBIEN SE MUERE X USTEDES.

    DEJENME UN MENSAJE OP SU CORREO DE LOS TRES BUENO XAOOOOO….

    Responder

  45. Alex
    Abr 06, 2009 @ 05:34:00

    JAJAJAJAJAJAJA

    kien mierda se han creido estos chibolos para cobrar tan caro x un concierto grabado q van a dar? como es posible q pagen tanto por ir a ver a esos inutiles? x favor piensen un poco y no hagan gastar a sus padres en estupideces. Jonas brothers es una banda creada por DISNEY y como todo lo q hace disney es falso, el q tengan su pelicula en la q hacen la finta de tocar no significa q sepan hacerlo. Esta clase de grupos toca en sus conciertos con pista, nada es en vivo es pura finta es como q lo vieran en su dvd. Gente de más de 16 años q scuche a estos, dense cuenta de lo q hacen uds ya estan viejos para seguir a una bandita plastica pop (no Rock como falsamente se hacen llamar, cualquiera con el minimo conocimiento sobre musica sabe q lo q estos chibolos hacen no es rock ni aca ni en marte) asi q por favor… MATENLOS xD

    Responder

  46. gustavo simon
    Abr 09, 2009 @ 15:04:24

    tienes rason alex,quien va a querer gastar a sus
    padres para ver a esos estupidos,ademas las
    entradas de kiss estan mas baratas de que esos
    estupidos jonas,ellos no saben cantar
    solo lo sacan de un disco y disimulan q estan
    cantando,son unos idiotas cobardes
    kiss son los numero 1 y tambien queen

    Responder

  47. anonimo
    Abr 09, 2009 @ 15:07:05

    los jonas brothers son unos idiotas

    Responder

  48. naomi
    Abr 09, 2009 @ 22:58:31

    kkkkkkkk como q vienen a lima q emocion
    hago cualquier cosa solopor verlo

    los quiero muchooooooo

    i love joe
    i love nick

    Responder

  49. nataly
    Abr 10, 2009 @ 01:06:01

    los jonas brother son una banda spectacular
    m encataria ir a verlosss!

    Responder

  50. GERALDINE
    Abr 11, 2009 @ 01:42:02

    los jonas brothers son lo maximo y los mas guapos .

    Responder

  51. gustavo simon
    Abr 11, 2009 @ 13:33:50

    quien rayos va a querer ver a esos estupidos,son
    unos idiotas bauras,son muy feos,mueranse
    y todos sus fanaticos tambien q se mueran
    viva kiss,queen y iron maiden
    chupemenla jonas brothers

    Responder

  52. gustavo simon
    Abr 11, 2009 @ 13:35:38

    ha se me olvidaba algo,laura a mi no me pueden meter a la carcel,tengo 12 años,estupidos jonas brothers

    Responder

  53. sabit ortiz
    Abr 14, 2009 @ 01:45:50

    Hello jonas I am sabit of peru, my minor sister is charmed with his(her,your) music to my and, me gustaria being able to know them, but I believe that it(he,she) is not possible, bye they take care and kisses for all especially for joe, that I am charmed with, I order them many kisses.

    Responder

  54. gustavo simon
    Abr 18, 2009 @ 04:21:03

    perdonenme por los insultos,no fue mi intension

    Responder

  55. juan elias
    Abr 19, 2009 @ 22:49:36

    !!!!!!!!!!!!bien los jhonas brother q bacan es lo mas bacan q a podido ocurrrir en peru

    Responder

  56. eldandy
    Abr 24, 2009 @ 14:28:41

    Sin palabras… La verdad es que ultimamente han llegado buenos, grupos con buena trascendencia, pero no se cual es la rotura de esa brecha, y solo por dinero (ya que vendes estos patas), traen grupos sin historia musical. Es gracioso por que este gruupito me recuerda a los parchis o a los tipicos servando y florentino, claro en version americana. jajajajaja… Bien por los que ran a este concierto, peor creo que hay mejores opciones. Ni modo ps cada uno con su musica y con sus costumbres…

    Responder

  57. eldandy
    Abr 24, 2009 @ 14:29:17

    Sin palabras… La verdad es que ultimamente han llegado buenos, grupos con buena trascendencia, pero no se cual es la rotura de esa brecha, y solo por dinero (ya que vendes estos patas), traen grupos sin historia musical. Es gracioso por que este gruupito me recuerda a los parchis o a los tipicos servando y florentino, claro en version americana. jajajajaja… Bien por los que ran a este concierto, peor creo que hay mejores opciones. Ni modo ps cada uno con su musica y con sus costumbres…

    Responder

  58. eldandy
    Abr 24, 2009 @ 14:30:52

    Sin palabras… La verdad es que ultimamente han llegado buenos grupos con buena trascendencia, pero no se cual es la rotura de esa brecha, y solo por dinero (ya que vendes estos patas), traen grupos sin historia musical. Es gracioso por que este gruupito me recuerda a los parchis o a los tipicos servando y florentino, claro en version americana. jajajajaja… Bien por los que ran a este concierto, pero creo que hay mejores opciones. Ni modo ps cada uno con su musica y con sus opcionae smusicales.

    MEJOR GASTEN SUS ESFUERZOS PERO POR R. ARJONA O LAURA PAUSINI. …… psssss

    Responder

  59. eldandy
    Abr 24, 2009 @ 14:31:48

    VENGA LAURA PAUSSINI

    VENGA RICARDO ARJONA

    VENGA ROXETTE

    VENGA FRANCO DE VITA…… jajajaja …si si

    Responder

  60. eldandy
    Abr 24, 2009 @ 14:33:50

    jajajaja… guapos…???¿¿¿ los Jonas… recuerdo que lo mismo decian de los parchis, servando y florentino… tipico comentario de mucha gente que ve llegar extranjeritos…jajajaja

    Responder

  61. eldandy
    Abr 24, 2009 @ 14:38:21

    karina // Abril 5, 2009 a 9:05 pm | Responder

    luego de leer algunos de lso comentarios quisiera expresar mi preocupacion por el precio de las entradas, estan incentivando con esto el emcaprichamiento de las ninias que no entienden el valor del dinero y que exigen quiza no verbal pero si psicologicamente a sus padres a comprarles estas entradas que estan terriblemente caras. Creo que deben tomar con cuidado temas como el fanatismo. Pueden amar a los JB pero deben entender que hay cosas que se pueden cumplir y otras que no.

    Tu opinion es magnifica…KARINA…

    PD. Espero que muchas chix sepan entender estas cosas y no se encaprichen por un grupete del momento…jajaja…. creado por Disney….

    Responder

  62. tony
    Abr 24, 2009 @ 23:28:02

    chicas y muchachos tengo entradas para jonas brothers ,general y en cancha a buen precio llamar al 991857485 mi correo es tony_252000@hotmail.com

    Responder

  63. tony
    Abr 24, 2009 @ 23:30:41

    TENGO ENTRADAS PARA JONAS BROTHERS Y OASIS TANBIEN LLAMAR AL 991857485 OAL 7894005 PREGUNTAR POR TONY.

    Responder

  64. angie y yoselin
    Abr 25, 2009 @ 20:11:45

    KIERO ESTAR EN EL CONCIERTO DE LOS JONAS BROTHERS PERO NO TENGO ENTRADA X ESO NO BOY A IR AL CONCIERTO CHAYITO……………? -_-

    Responder

  65. ninos!!!
    Abr 25, 2009 @ 23:08:08

    como vendran a peru yo supongo q llegaran a venir a cusco donde espero se mueran de soroche , o yo los voy a abatir…ya tengo un grupo de 5o personas y todas somos anti- fans de estos malditos espero q ya no vuelvan….buajajaja

    Responder

  66. EsTreLlA
    Abr 26, 2009 @ 15:46:25

    ggguuuuuuuuuaaaaaaaaaauuuuuuu los jonas brother en Lima!!!!!! kisiera estar alliiii…wwweeeennnnnoooo es una de las mejores bandas del mundoooooooooo

    Responder

  67. EsTreLlA
    Abr 26, 2009 @ 15:54:07

    kisiera estar en el concierto de ustedes pero no voi a poder pero espero que regalen entradas puuueeeeeeeessssss plllliiiiiiissssssss para las fans y no solo para lima sino para las provincias…!!!!!!!!

    Responder

  68. sofiaaaaaaaaa
    Abr 29, 2009 @ 23:10:32

    los amo jonasssssssss en especial a nick y a joe

    Responder

  69. jihannaa
    Abr 30, 2009 @ 00:22:43

    esos xicos son tan simpaticos………..los kiero mux´chooooooo

    Responder

  70. Diego
    Abr 30, 2009 @ 21:59:42

    HOLAA SOY FAN DE LOS JB AUKE SOY HOMBRE BUENO ESO NO INTEREZA KIERO SABER ZI LOS JONAS VIENEN A LIMA POR LA GRIPE PORCINA XQ YO YA TENGO MIS ENTRADAS DE GOLDEN CIRCLE POR FAVOR KIERO SABER SI VIENEN XQ SE CANCELO EL CONCIERTO DE MEXICO Y NO KIERO Q CANCELEN EL DE PERU AZI Q CHICHAS (O) CUIDENSE POR LA GRIPE PORCINA

    Responder

  71. adriana cardenas
    May 04, 2009 @ 00:51:19

    xikOz tngO entradas para el super concierto…zona tribuna…las vendo a 90 soles, este es mi correo samanta.ah@hotmail.com, escriban solo si estan interesados…. solo tengo 2 entradas! .. ah! podemos negociar =D

    Responder

  72. stephanie
    May 09, 2009 @ 19:14:27

    joe me encantaria ir a tu concierto pero no puedo

    Responder

  73. kathysita
    May 09, 2009 @ 22:17:43

    pusha vinen los jobrossssssssssssssss
    que buenoppppppppppplos adoro son lo maximoooooooooo
    quiero ir al conciert
    por dios
    pero nop puedo
    i love nick and joe
    los amoooooooooo
    quiero ir al conciert
    regalen entradas pssssssssssss
    por fa

    plisssssssssssssssssssssssssss

    Responder

  74. kathysita
    May 09, 2009 @ 22:19:43

    ya p0a

    por fa no san malos regalen entradas amitos

    de repen tieneb de mas

    por faaaaaaaaaaaaaa

    ay dios m emuero

    los amo

    jonas brothers

    y esos inbeciles a quienes nop le gustan

    q se adon de ya saben y no jo—-an

    idiotas

    Responder

  75. lupitahh..!!!
    May 11, 2009 @ 01:41:16

    puxa si lo les gustah los jonas brothers mejor qedense caiaditos ia solo stan celosos porq son muy talentonsis y ustedes un pedazo de badura solo oqeiii ..!!! asiq al qoncierto carambas..!!
    LOS AMO JONAS BROTHERS…!!ENSERIO LOS AAMO..!!puxa enserio lo dogo wqon sentimientoh son lo mejor q me a pasado en la vida ustedes son gransiosos son mury taklentonsos y me enqabnta su forma de ser de qada uno son lo mejor..!!!

    LOS AMO JONAS BROTHERS..!! EN SERIO LOS AMO..!!

    Responder

  76. PATY
    May 19, 2009 @ 23:51:06

    WA DE VERDAD Q DAN LASTIMA ESOS ENFERMOS MENTALES Q HABLAN MAL DE LOS JONAS BROTHERS SON UNO PICONES ODIOSOS Y PIRAÑITAS A LA VERDAD ME DAN LASTIMA NO SE Q LES DA PARA HABLAR ASI DE LOS JONAS BROTHERS BUENO YO ESTOY RECONTRA SUPER FELIZ POR VER ALOS JONAS EN CONCIERTO YA ME COMPRE MI ENTRADA PARA VER ALOS GUAPISIMOS DE LOS JONAS PQ REALMENTE SON HERMOSISIMOS SOBRE TODO JOE Q LO AMO TANTO ES SUPER LINDO QUE BACAN TOY FELIZ Y Q BACAN Q HAGAN DOBLE CONCIERTO ESTOY EMOCIONADISIMA ES Q ELLOS SON UN FENOMENO EN LA MUSICA DUELA A QUIEN LE DUELA SI NO LES GUSTA SU MUSICA SIMPLEMENTE NO LO ESCUCHEN PS TOTAL NADIE LOS OBLIGA Y DEJEN EN PAZ A LOS Q AMAN A LOS JONAS PQ TOTAL SON NUESTROS GUSTOS, NUESTROS DINEROS, NUESTRO TIEMPO Y NUESTRA VIDA Y ESO A NADIE DEBE INTERESARLE Y DEJEN DE HABLAR CURSILERIAS PQ USTEDES SOLOS SE QUEMAN EL HIGADO Y DEJEN DE FRUSTRARSE POR EL EXITO DE OTROS LOS AMOOOOOOOOO JONAS BROTHERS SALUDOS A TODAS LAS JONATICAS DE CORAZONNN Q AMAMOS A LOS JONAS CON EL ALMAAAA TE AMOOO JOEEE JONASSS

    Responder

  77. stuart
    May 22, 2009 @ 22:05:23

    Empezaron con una cancion de los white stripes,luego tienen una cancion plagiadasa del exito de kim wilde del 81 kids in america,realmente es una bandita de medio pelo,pero a las chibolas brutas y aguantadas solo les interesa gritar para desfogar su represion sexual,por esa razon los beatles dejaron de hacer conciertos….carisimas las entradas,no lo valen……pero en fin al menos este año todos hemos tenido conciertos,brutos,inteligentes,poperos,metaleros,chibolos,tios,rosquetes,punteadores,etc,y es bueno q asi sea,nomas como se les ocurre cerrar el nacional y si viene MACCA o ACDC donde van a tocar? la explanada es una mierda como lugar para conciertos asi q busquen mejores alternativas.

    Responder

    Responder

  78. Melissa Loza
    May 24, 2009 @ 23:49:27

    si eso de que el munumental es una mierda para hacer conciertos es verdad deve de ser una mierda todo ese estadio y no sirve deverian de drrumbarlo. y como no va hacer una mierda si es el estadio de la peor cagada del Peru ps. Osea de la U

    Responder

  79. Fans de los Jonas
    May 24, 2009 @ 23:53:18

    es una porqueria ese estadio.. tiene razon melissa no sirve ese estadio… felizmente los Jonas brothers son hinchas del alianza lima como a Jeo le gusta el futbol le gusto la camiseta del alianza lima.. asi que chikas del Peru hay que ser Hincha del Alianza Lima por los Jonas Brothers ehhhh Te amo Joeeeeeee y ARRIBA ALIANZA y quemen ese gallinero de la U y nunca le entregaremos su banderola Muahahahaha Muahahaha

    Responder

  80. mo0xa
    Oct 27, 2009 @ 22:28:56

    wo0lix so0lo0 kiero0
    k sepan k so0n lo0 mejo0r
    o0jala y algun dia mi suño0 se haga realidad
    jiji wueno0 k wueno k van a venir
    a mexico hoho wueno xhao0
    i love jonas 4 ever
    atto iio0

    Responder

  81. margot
    Ago 14, 2010 @ 02:47:42

    hola extraudinario escuchar sus musicas me encanta escuchar cuanti quisiera verlos bye cuidanse

    Responder

Responder

Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de WordPress.com

Estás comentando usando tu cuenta de WordPress.com. Cerrar sesión / Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Cerrar sesión / Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Cerrar sesión / Cambiar )

Google+ photo

Estás comentando usando tu cuenta de Google+. Cerrar sesión / Cambiar )

Conectando a %s

A %d blogueros les gusta esto: