Jonas Brothers en Lima

jonasJonas Brothers, una de las más famosas bandas de pop de la actualidad, anunció que iniciará una serie de presentaciones por Latinoamérica y Estados Unidos, que incluye una fecha para nuestra capital, el próximo martes 19 de mayo.

Kevin, Joe y Nick informaron a todos sus fanáticos la lista oficial del tour a través de MySpace y la web oficial de los Jonas Brothers, aunque aún no se ha definido el lugar donde tocarán sus electricos temas como ‘Kids of the Future’.

Estos tres hermanos que la vienen rompiendo tras ganar gran popularidad en Disney Channel y la película ‘Camp Rock’, pisarán suelo peruano en su máximo apogeo, antes de viajar a Chile, Argentina y Brasil.

¿Quiénes son los Jonas Brothers?
Los Jonas Brothers son una banda pop originaria de Nueva Jersey, Estados Unidos, compuesta por tres hermanos: Kevin, Joe y Nick Jonas. Tiene gran acogida entre el público infantil y adolescente.
Han publicado tres álbumes de estudio ‘It’s About Time’ en 2006, ‘Jonas Brothers’ en 2007, y ‘A Little Bit Longer’ en 2008, además de estrenar este año el ‘Jonas Brothers: The 3D Concert Experience Sound Track’.
También han realizado películas como ‘Jonas Brothers: Living the Dream’, ‘J.O.N.A.S!’ y ‘Camp Rock 1 y 2’.
El 2008 ganaron el premio MTVLA a ‘Mejor artista pop internacional’ y ‘Mejor fashionista (Joe Jonas)’.
Jonas Brothers – Burnin Up
Jonas Brothers – Kids of the Future

81 comentarios (+¿añadir los tuyos?)

  1. sandy
    Mar 14, 2009 @ 17:48:42

    wuuuuu!!! los jonas brothers en lima siiiiii!!!
    ellos son la mejor banda de todo el mundooo!!


  2. jessica
    Mar 17, 2009 @ 23:13:04

    waooooooooooooooo!!!! no lo puedo kreer!!!!!!
    ovbio k tngo k ir adelantito obvio


  3. carla
    Mar 19, 2009 @ 02:39:45

    los amo …voy a hacer de todo por verlos ..los amo …joe (L)


  4. mariana
    Mar 19, 2009 @ 11:50:20

    Ola! estoy re emocionada x favor si a lguien sabe cuanto estan las entradas para peru i donde las venden agregenme


  5. kimi
    Mar 20, 2009 @ 02:32:23

    wauuu esta es una emocion grandiosa,tanto que los esperabamos ya van a estar aqui el 19 de mayo que locura ovio que tengo que ir


  6. JOEL
    Mar 20, 2009 @ 18:46:05



  7. cathy y kenny escudero ramirez
    Mar 21, 2009 @ 15:06:33

    somos sus fans los amamos sus musica son de sentimiento y ademas son lindooooooooooos .
    nosotras queremos sus autografos no faltaremos al concierto en primera fila . los queremos JOE,NICK,KEVIN


  8. crtius
    Mar 22, 2009 @ 00:56:45

    Hello!! Jonas usdtsss!! son de lo mejor aun que no los conosca del todo… bueno ahi los vere donde sea que esten … derre me hago pasar por una reportera =) …


  9. maferrr.!
    Mar 22, 2009 @ 18:44:10

    obviiO q tengO q iR esta brabazO.. ! lOs jonas estan en sintonia..! bravazo cuanto estan las entradas???? manden si? I lOve jOe..!


  10. valeria
    Mar 24, 2009 @ 20:47:39

    ahi quiero decirles que los amo mas a jouuuuuuuuuuuuuuu
    me encantan sus canciones soy su fan numero uno los amooooooooooooooooooooooooooooooooooooooooooooooooo y ovioooooooooooooooooo que voy asu concierto de este año osea año


  11. valeria
    Mar 24, 2009 @ 20:47:44

    ahi quiero decirles que los amo mas a jouuuuuuuuuuuuuuu
    me encantan sus canciones soy su fan numero uno los amooooooooooooooooooooooooooooooooooooooooooooooooo y ovioooooooooooooooooo que voy asu concierto de este año osea año


  12. valeria
    Mar 24, 2009 @ 20:50:10

    hay quiero decirles que los adoro ovio que mas a jou ahy te amo bueno a los tres y oviooooooooooo que voy a su concierto de este año osea año 2009

    los adorooooooooooooooo


    Mar 24, 2009 @ 23:04:12

    ENTRADAS GRATIS…solo para las chikas atrevidas que deseen unas entradas gratis, para el primer y quizas unico concierto de los Jonas brothers.. solo chikas dispuesta a todo.. por unas entradas para el unico concierto en lima … las chikas positivas y atrevidas escribirme a mi correo
    solo chikas atrevidas nada mas..


    Mar 24, 2009 @ 23:05:56

    las entradas estarn mino 120 soles la general y las mas caras zona vip 500 soles


  15. Jack(y)
    Mar 27, 2009 @ 00:29:10

    deveras …eson son los precios??????????
    y donde va serr???


  16. gustavo simon
    Mar 28, 2009 @ 14:40:10

    los jonas brothers son uno cobardes basuras de mierda , el concierto de kiss va a estar mas bravaso, viva queen, kiss y iron maiden


  17. jimena
    Mar 28, 2009 @ 22:31:03

    los amo…… siempre quieze q vinieran ovio q voy a estsar a primera fila lo amo a joeeeeeeeeeeeeeeeeeeeeeeee
    estoy felis pero tengo q averiguar ojala q sea en el monumental para q valla tanta gente q se muere po ir


  18. anonimo
    Mar 29, 2009 @ 01:28:32

    atrevanse a venir a lima cabrones de
    mierda yo los buscare y los matare
    me bañare en su sangre y a todos sus
    fanaticos y tambien a su productor y


  19. gustavo simon
    Mar 29, 2009 @ 12:35:04

    mueranse jonas brothers,ya se su secreto
    violaron a una anciana para el colmo desnudos
    ya los ampaye cabrones de mierda,tambien me entere q hablron mal de queen y de kiss
    ustedes los jonas brothers no valen nada
    mueranse malditos,los jonas brothers son unos


  20. yo soi :)
    Mar 30, 2009 @ 22:52:04




  21. MAI
    Mar 30, 2009 @ 22:53:57




  22. MAI
    Mar 30, 2009 @ 22:54:02




  23. fiorellita
    Mar 31, 2009 @ 00:21:33

    super estare en primera fila
    no me la prdere.
    por naa delmundo aunq llueva


  24. iO phee..^^!
    Mar 31, 2009 @ 21:46:14

    ENTRADAS GRATIS…solo para las chikas atrevidas que deseen unas entradas gratis, para el primer y quizas unico concierto de los Jonas brothers.. solo chikas dispuesta a todo.. por unas entradas para el unico concierto en lima … las chikas positivas y atrevidas escribirme a mi correo
    solo chikas atrevidas nada mas..


    ii ezteh??..
    qe creeh qe le vamoz..
    azer cazO..!
    taz weon..
    buzcateh en OtrO ladO..
    a xiqaz ardientez….
    daz pena..
    tan necezitadO eztaz??
    ajjj daz pena!


  25. gustavo simon
    Abr 01, 2009 @ 19:00:56

    no me interesa sus comentarios,igual los mato
    custe lo que cueste,ya se cuando van a venir
    y en que estadio y a que hora,yo vendre armado
    y los 3 moriran 1×1,jonas brothers mueranse
    cabrones de mieda,ya estoy preparado
    viva kiss,queen y iron maiden


  26. melany
    Abr 01, 2009 @ 19:58:39

    holas chicos estoy contenta que venga a peru
    soy una niña de nueve años
    y soy fan de ustedes


  27. melany
    Abr 01, 2009 @ 20:03:07

    chicos quiero pedirles algo


  28. melany
    Abr 01, 2009 @ 20:10:13

    una perganta demi lovato viene


  29. io!!
    Abr 02, 2009 @ 05:06:30

    ES JOE!








  30. Carmen
    Abr 02, 2009 @ 18:02:20

    Chicas URGENTE
    Por favor no den sus correos personales a NADIE, no den sus datos, no se citen con nadie… y menos confien en que les regalaran entradas.
    Eso es MENTIRA, esa persona solo quiere abusar de ustedes, engañarlas, hacerles daño.
    Por favor CUIDENSE, valorense, no se arriesguen.



  31. laura
    Abr 02, 2009 @ 22:08:53



  32. laura
    Abr 02, 2009 @ 22:09:47

    la mas cara esta 1306.7 soles


  33. humberto
    Abr 02, 2009 @ 22:49:37

    quiero saber cuanto tan las entradas gracias


  34. Ximena
    Abr 03, 2009 @ 02:30:24

    mas de 1000 soles la mas cara????? por dios!! es un escandalooo un escandalo totaaaaal!!!!!!!!!!!!!!!!!!!!!!! que pena que tan caras las entradas en verdad que sip…queria llevara mi hijita que ama a los jonas adelante pero taan carooo?? dios mio!!!! ni siquiera U2 cobraria asi!!!! ESCANDALOOO y LOs impuestos reducidos en donde estan en este caso????


  35. ALIAS
    Abr 03, 2009 @ 04:17:35



  36. lidia
    Abr 03, 2009 @ 14:40:06

    siiiiiiiiiiiiiiiiiiiiiiiiiiiiiii los amoooooooooooooooooooo
    pense k nunka vendriaaaaannnnnnnn!!!!!! no l puedo creer!!!!!
    alguien ya kompro su entrada ????
    kuanto estann???????


  37. Renato
    Abr 03, 2009 @ 22:00:05

    Nadie a comprado entradas porque ni comerciales y a mi tambien me gusta.


  38. belu
    Abr 03, 2009 @ 23:23:43

    los amo especial mente a nick es un bombom tengo todas sus fotos bengan a salta capital argentina loooooooooooooooooooooooooooooosssssssssssssssssssssssssssssssssssssssssssss aaaaaaaaaaaaaaaaammmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmoooooooooooooooooooooooooooooooooooooooooo


  39. angela
    Abr 04, 2009 @ 04:16:08

    oye no lo puedo creer yo me apunto y me subo hayyyyyyyyyyyyyyyyyyyyy los amos jonas brothers soy su fans numero 1 de peru


  40. andreiitap
    Abr 04, 2009 @ 18:05:29

    oLz aKii lz djo l PrEZiio dE laz nTrAdAz

    GOLDEN CIRCLE – NORMAL – S/. 1306.7
    BURNIN UP – NORMAL – S/. 1120
    LOVEBUG – A – NORMAL – S/. 840
    WE ROCK PALCO – NORMAL – S/. 786.7
    WE ROCK VIP – NORMAL – S/. 720
    LOVEBUG – B -NORMAL – S/. 693.3
    MANDY – NORMAL – S/. 586.7
    LOVEBUG – C – NORMAL – S/. 560
    YEAR 3000 – NORMAL – S/. 293.3
    S.O.S. – A – NORMAL – S/. 253.3
    S.O.S. – B – NORMAL – S/. 160
    S.O.S. – C – NORMAL – S/. 106.7
    TRIBUNA – NORMAL – S/. 53.3


  41. july
    Abr 04, 2009 @ 19:51:09

    les queria preguntar si saven cuando yegan los jonas a argentina y donde aterrisan.gracias july .
    i love jonas brathers
    i love joe jonas¡¡¡¡¡¡¡te amooooo¡¡


  42. july
    Abr 04, 2009 @ 19:54:14

    les queria preguntar si saven cuando yegan los jonas a argentina y donde aterrisan.gracias july .
    i love jonas brathers
    i love joe jonas¡¡¡¡¡¡¡te amooooo¡¡


  43. karina
    Abr 05, 2009 @ 21:05:15

    luego de leer algunos de lso comentarios quisiera expresar mi preocupacion por el precio de las entradas, estan incentivando con esto el emcaprichamiento de las ninias que no entienden el valor del dinero y que exigen quiza no verbal pero si psicologicamente a sus padres a comprarles estas entradas que estan terriblemente caras. Creo que deben tomar con cuidado temas como el fanatismo. Pueden amar a los JB pero deben entender que hay cosas que se pueden cumplir y otras que no.


  44. angie
    Abr 06, 2009 @ 01:36:05




  45. Alex
    Abr 06, 2009 @ 05:34:00


    kien mierda se han creido estos chibolos para cobrar tan caro x un concierto grabado q van a dar? como es posible q pagen tanto por ir a ver a esos inutiles? x favor piensen un poco y no hagan gastar a sus padres en estupideces. Jonas brothers es una banda creada por DISNEY y como todo lo q hace disney es falso, el q tengan su pelicula en la q hacen la finta de tocar no significa q sepan hacerlo. Esta clase de grupos toca en sus conciertos con pista, nada es en vivo es pura finta es como q lo vieran en su dvd. Gente de más de 16 años q scuche a estos, dense cuenta de lo q hacen uds ya estan viejos para seguir a una bandita plastica pop (no Rock como falsamente se hacen llamar, cualquiera con el minimo conocimiento sobre musica sabe q lo q estos chibolos hacen no es rock ni aca ni en marte) asi q por favor… MATENLOS xD


  46. gustavo simon
    Abr 09, 2009 @ 15:04:24

    tienes rason alex,quien va a querer gastar a sus
    padres para ver a esos estupidos,ademas las
    entradas de kiss estan mas baratas de que esos
    estupidos jonas,ellos no saben cantar
    solo lo sacan de un disco y disimulan q estan
    cantando,son unos idiotas cobardes
    kiss son los numero 1 y tambien queen


  47. anonimo
    Abr 09, 2009 @ 15:07:05

    los jonas brothers son unos idiotas


  48. naomi
    Abr 09, 2009 @ 22:58:31

    kkkkkkkk como q vienen a lima q emocion
    hago cualquier cosa solopor verlo

    los quiero muchooooooo

    i love joe
    i love nick


  49. nataly
    Abr 10, 2009 @ 01:06:01

    los jonas brother son una banda spectacular
    m encataria ir a verlosss!


    Abr 11, 2009 @ 01:42:02

    los jonas brothers son lo maximo y los mas guapos .


  51. gustavo simon
    Abr 11, 2009 @ 13:33:50

    quien rayos va a querer ver a esos estupidos,son
    unos idiotas bauras,son muy feos,mueranse
    y todos sus fanaticos tambien q se mueran
    viva kiss,queen y iron maiden
    chupemenla jonas brothers


  52. gustavo simon
    Abr 11, 2009 @ 13:35:38

    ha se me olvidaba algo,laura a mi no me pueden meter a la carcel,tengo 12 años,estupidos jonas brothers


  53. sabit ortiz
    Abr 14, 2009 @ 01:45:50

    Hello jonas I am sabit of peru, my minor sister is charmed with his(her,your) music to my and, me gustaria being able to know them, but I believe that it(he,she) is not possible, bye they take care and kisses for all especially for joe, that I am charmed with, I order them many kisses.


  54. gustavo simon
    Abr 18, 2009 @ 04:21:03

    perdonenme por los insultos,no fue mi intension


  55. juan elias
    Abr 19, 2009 @ 22:49:36

    !!!!!!!!!!!!bien los jhonas brother q bacan es lo mas bacan q a podido ocurrrir en peru


  56. eldandy
    Abr 24, 2009 @ 14:28:41

    Sin palabras… La verdad es que ultimamente han llegado buenos, grupos con buena trascendencia, pero no se cual es la rotura de esa brecha, y solo por dinero (ya que vendes estos patas), traen grupos sin historia musical. Es gracioso por que este gruupito me recuerda a los parchis o a los tipicos servando y florentino, claro en version americana. jajajajaja… Bien por los que ran a este concierto, peor creo que hay mejores opciones. Ni modo ps cada uno con su musica y con sus costumbres…


  57. eldandy
    Abr 24, 2009 @ 14:29:17

    Sin palabras… La verdad es que ultimamente han llegado buenos, grupos con buena trascendencia, pero no se cual es la rotura de esa brecha, y solo por dinero (ya que vendes estos patas), traen grupos sin historia musical. Es gracioso por que este gruupito me recuerda a los parchis o a los tipicos servando y florentino, claro en version americana. jajajajaja… Bien por los que ran a este concierto, peor creo que hay mejores opciones. Ni modo ps cada uno con su musica y con sus costumbres…


  58. eldandy
    Abr 24, 2009 @ 14:30:52

    Sin palabras… La verdad es que ultimamente han llegado buenos grupos con buena trascendencia, pero no se cual es la rotura de esa brecha, y solo por dinero (ya que vendes estos patas), traen grupos sin historia musical. Es gracioso por que este gruupito me recuerda a los parchis o a los tipicos servando y florentino, claro en version americana. jajajajaja… Bien por los que ran a este concierto, pero creo que hay mejores opciones. Ni modo ps cada uno con su musica y con sus opcionae smusicales.



  59. eldandy
    Abr 24, 2009 @ 14:31:48




    VENGA FRANCO DE VITA…… jajajaja …si si


  60. eldandy
    Abr 24, 2009 @ 14:33:50

    jajajaja… guapos…???¿¿¿ los Jonas… recuerdo que lo mismo decian de los parchis, servando y florentino… tipico comentario de mucha gente que ve llegar extranjeritos…jajajaja


  61. eldandy
    Abr 24, 2009 @ 14:38:21

    karina // Abril 5, 2009 a 9:05 pm | Responder

    luego de leer algunos de lso comentarios quisiera expresar mi preocupacion por el precio de las entradas, estan incentivando con esto el emcaprichamiento de las ninias que no entienden el valor del dinero y que exigen quiza no verbal pero si psicologicamente a sus padres a comprarles estas entradas que estan terriblemente caras. Creo que deben tomar con cuidado temas como el fanatismo. Pueden amar a los JB pero deben entender que hay cosas que se pueden cumplir y otras que no.

    Tu opinion es magnifica…KARINA…

    PD. Espero que muchas chix sepan entender estas cosas y no se encaprichen por un grupete del momento…jajaja…. creado por Disney….


  62. tony
    Abr 24, 2009 @ 23:28:02

    chicas y muchachos tengo entradas para jonas brothers ,general y en cancha a buen precio llamar al 991857485 mi correo es


  63. tony
    Abr 24, 2009 @ 23:30:41



  64. angie y yoselin
    Abr 25, 2009 @ 20:11:45



  65. ninos!!!
    Abr 25, 2009 @ 23:08:08

    como vendran a peru yo supongo q llegaran a venir a cusco donde espero se mueran de soroche , o yo los voy a abatir…ya tengo un grupo de 5o personas y todas somos anti- fans de estos malditos espero q ya no vuelvan….buajajaja


  66. EsTreLlA
    Abr 26, 2009 @ 15:46:25

    ggguuuuuuuuuaaaaaaaaaauuuuuuu los jonas brother en Lima!!!!!! kisiera estar alliiii…wwweeeennnnnoooo es una de las mejores bandas del mundoooooooooo


  67. EsTreLlA
    Abr 26, 2009 @ 15:54:07

    kisiera estar en el concierto de ustedes pero no voi a poder pero espero que regalen entradas puuueeeeeeeessssss plllliiiiiiissssssss para las fans y no solo para lima sino para las provincias…!!!!!!!!


  68. sofiaaaaaaaaa
    Abr 29, 2009 @ 23:10:32

    los amo jonasssssssss en especial a nick y a joe


  69. jihannaa
    Abr 30, 2009 @ 00:22:43

    esos xicos son tan simpaticos………..los kiero mux´chooooooo


  70. Diego
    Abr 30, 2009 @ 21:59:42



  71. adriana cardenas
    May 04, 2009 @ 00:51:19

    xikOz tngO entradas para el super concierto…zona tribuna…las vendo a 90 soles, este es mi correo, escriban solo si estan interesados…. solo tengo 2 entradas! .. ah! podemos negociar =D


  72. stephanie
    May 09, 2009 @ 19:14:27

    joe me encantaria ir a tu concierto pero no puedo


  73. kathysita
    May 09, 2009 @ 22:17:43

    pusha vinen los jobrossssssssssssssss
    que buenoppppppppppplos adoro son lo maximoooooooooo
    quiero ir al conciert
    por dios
    pero nop puedo
    i love nick and joe
    los amoooooooooo
    quiero ir al conciert
    regalen entradas pssssssssssss
    por fa



  74. kathysita
    May 09, 2009 @ 22:19:43

    ya p0a

    por fa no san malos regalen entradas amitos

    de repen tieneb de mas

    por faaaaaaaaaaaaaa

    ay dios m emuero

    los amo

    jonas brothers

    y esos inbeciles a quienes nop le gustan

    q se adon de ya saben y no jo—-an



  75. lupitahh..!!!
    May 11, 2009 @ 01:41:16

    puxa si lo les gustah los jonas brothers mejor qedense caiaditos ia solo stan celosos porq son muy talentonsis y ustedes un pedazo de badura solo oqeiii ..!!! asiq al qoncierto carambas..!!
    LOS AMO JONAS BROTHERS…!!ENSERIO LOS AAMO..!!puxa enserio lo dogo wqon sentimientoh son lo mejor q me a pasado en la vida ustedes son gransiosos son mury taklentonsos y me enqabnta su forma de ser de qada uno son lo mejor..!!!



  76. PATY
    May 19, 2009 @ 23:51:06



  77. stuart
    May 22, 2009 @ 22:05:23

    Empezaron con una cancion de los white stripes,luego tienen una cancion plagiadasa del exito de kim wilde del 81 kids in america,realmente es una bandita de medio pelo,pero a las chibolas brutas y aguantadas solo les interesa gritar para desfogar su represion sexual,por esa razon los beatles dejaron de hacer conciertos….carisimas las entradas,no lo valen……pero en fin al menos este año todos hemos tenido conciertos,brutos,inteligentes,poperos,metaleros,chibolos,tios,rosquetes,punteadores,etc,y es bueno q asi sea,nomas como se les ocurre cerrar el nacional y si viene MACCA o ACDC donde van a tocar? la explanada es una mierda como lugar para conciertos asi q busquen mejores alternativas.



  78. Melissa Loza
    May 24, 2009 @ 23:49:27

    si eso de que el munumental es una mierda para hacer conciertos es verdad deve de ser una mierda todo ese estadio y no sirve deverian de drrumbarlo. y como no va hacer una mierda si es el estadio de la peor cagada del Peru ps. Osea de la U


  79. Fans de los Jonas
    May 24, 2009 @ 23:53:18

    es una porqueria ese estadio.. tiene razon melissa no sirve ese estadio… felizmente los Jonas brothers son hinchas del alianza lima como a Jeo le gusta el futbol le gusto la camiseta del alianza lima.. asi que chikas del Peru hay que ser Hincha del Alianza Lima por los Jonas Brothers ehhhh Te amo Joeeeeeee y ARRIBA ALIANZA y quemen ese gallinero de la U y nunca le entregaremos su banderola Muahahahaha Muahahaha


  80. mo0xa
    Oct 27, 2009 @ 22:28:56

    wo0lix so0lo0 kiero0
    k sepan k so0n lo0 mejo0r
    o0jala y algun dia mi suño0 se haga realidad
    jiji wueno0 k wueno k van a venir
    a mexico hoho wueno xhao0
    i love jonas 4 ever
    atto iio0


  81. margot
    Ago 14, 2010 @ 02:47:42

    hola extraudinario escuchar sus musicas me encanta escuchar cuanti quisiera verlos bye cuidanse


Deja un comentario

Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de

Estás comentando usando tu cuenta de Cerrar sesión / Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Cerrar sesión / Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Cerrar sesión / Cambiar )

Google+ photo

Estás comentando usando tu cuenta de Google+. Cerrar sesión / Cambiar )

Conectando a %s

A %d blogueros les gusta esto: